Sampling stations were situated in eight transitional waters of the eastern English Channel along the French coasts (Fig. 2): four in Normandy in the Bay of Veys (BV: intertidal), the Orne estuary (O1: subtidal, O2: intertidal), the Caen-Ouistreham harbor (CO: subtidal) and Le Havre harbor (LHP: intertidal, recreational area, H1 to H5: subtidal, international shipping area) and three in the Hauts-de-France in the Authie estuary, Calais and Dunkirk harbors. In September 2019 in Normandy and September 2020 in the Hauts-de-France, one surface sediment sample was collected for grain size analysis and three replicates for total organic carbon and nitrogen. A Van Veen grab was used for the subtidal stations and a hand corer was used for the intertidal stations. For foraminiferal morphological analysis, three replicate cores were sampled at each station, with a Reineck corer for subtidal stations and a hand corer for intertidal ones (56 cm² in surface). Trochammina hadai-like specimens were only found in Normandy in Le Havre and Caen-Ouistreham harbors. Additional sediment samples were taken with a small Van Veen grab in May 2022 in Le Havre harbor for molecular investigations of Trochammina hadai-like specimens.

Figure 2. 

Sampling stations along the coasts in the eastern English Channel with a focus on Normandy where Trochammina hadai was found (black filled circle and unfilled triangle: presence and absence of T. hadai, respectively).

To assess sediment granulometry, laser diffraction particle-size analysis was carried out. Sediment grain size distribution has been subdivided in three fractions: clay (<2 µm), silt (2 to 63 µm) and sand (63 to 2000 µm) for physical characterization (i.e., energy of the environment). The three replicates of sediment samples for TOC and TN analysis were first frozen and then freeze-dried. They were preserved at -20 °C at the laboratory. Total organic carbon and nitrogen content was determined with an elemental analyzer (Thermofisher Flash 2000, Laboratory of Oceanology and Geosciences in Wimereux-France) and expressed as the % of Corg and Norg per total weight of dry sediment. The C/N ratio was calculated at each station to determine the terrestrial or marine origin of the organic matter. The amount of inorganic carbon and nitrogen (measured in samples heated at 550 °C for 5 hours) was subtracted.

Samples for morphological identification were preserved in ethanol and Rose Bengal solution (2 g L^-1). In the laboratory, samples were sieved through a 63 µm-mesh and the fraction >63 µm was dried at 50 °C in an incubator. Foraminifera were then concentrated by flotation using trichloroethylene (density = 1.46). At least 300 living (stained) benthic foraminifera individuals were collected and identified for each sample. Behavioral observations of this species confirmed that living specimens are present at sampling sites (unpublished data). Relative abundances of living Trochammina hadai-like specimens were then calculated. Sediment samples for molecular analysis were preserved in seawater at in-situ temperature (15 °C) and sieved at the laboratory on a 125 µm-mesh the day after sampling. Living specimens of T. hadai were placed on a microslide, dried at ambient temperature and sent to the University of Geneva, Switzerland. Specimen images were taken with a stereomicroscope using reflected light.

Living Trochammina specimens were morphologically identified based on the original type descriptions (Table 1).

Five Trochammina specimens were extracted individually using guanidine lysis buffer (Pawlowski 2000). Semi-nested PCR amplification was carried out for the 18S barcoding fragment of foraminifera (Pawlowski and Holzmann 2014) using primers s14F3 (acgcamgtgtgaaacttg)-sB (tgatccttctgcaggttcacctac) for the first and primers s14F1 (aagggcaccacaagaacgc)-sB for the second amplification. Thirty-five and 25 cycles were performed for the first and the second PCR, with an annealing temperature of 50 °C and 52 °C, respectively. The amplified PCR products were purified using the High Pure PCR Cleanup Micro Kit (Roche Diagnostics). Sequencing reactions were performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and analyzed on a 3130XL Genetic Analyzer (Applied Biosystems). The resulting sequences were deposited in the NCBI/GenBank database. Isolate and Accession numbers are specified in Table 2.

The obtained sequences were added to 44 sequences belonging to textulariids and Reophacidae that are part of the publicly available 18S database of foraminifera (NCBI/Nucleotide; https://www.ncbi.nlm.nih.gov/nucleotide/). All sequences were aligned using the default parameters of the Muscle automatic alignment option, as implemented in SeaView vs. 4.3.3. (Gouy et al. 2010). The alignment contains 49 sequences with 1192 sites used for analysis.

The phylogenetic tree was constructed using maximum likelihood phylogeny (PhyML 3.0) as implemented in ATGC: PhyML (Guindon et al. 2010). An automatic model selection by SMS (Lefort et al. 2017) based on Akaike Information Criterion (AIC) was used, resulting in a GTR+R substitution model being selected for the analysis. The initial tree is based on BioNJ. Bootstrap values (BV’s) are based on 100 replicates.

Most stations were characterized by the dominance of silt, with the exception of stations BV3, BV4 and O1 which were composed of a balanced mix of sand and silt had more than 40% of sand (Table 3). Total organic carbon content was similar between stations, typically ranging between 0.8 and 1.64% (Table 3). Total nitrogen content did not change between stations and was relatively low, around 0.02–0.04% (Table 3).

The indigenous Trochammina inflata exhibits inflated chambers, gradually increasing in size (see Table 1 for details). According to the type description (Montagu 1808), it has depressed sutures that are radial to slightly curved, a rounded periphery and a smoothly agglutinated wall surface.

The Trochammina specimens found in the Caen-Ouistreham and Le Havre harbors were distinct and characterized by a less lobulate periphery and shell is composed of big grains clearly visible under binocular (Fig. 3). In addition, chambers were subglobular, increasing in size during growth, and sutures were slightly curved dorsally, more depressed and nearly radial ventrally (Fig. 3). The morphological features strongly suggested that they belong to T. hadai (Table 1) and the assignment to the latter species was confirmed by molecular analysis.

Figure 3. 

Pictures of living Trochammina hadai specimens sampled in Le Havre harbor in May 2022. Photographs by Jean-Charles Pavard and Maria Holzmann.

The phylogenetic tree (Fig. 4) contains 49 sequences of agglutinated foraminifera and is rooted in Reophacidae (R. scorpiurus, R. spiculifer, R. curtus, R. pilulifera). The obtained sequences cluster with T. hadai, supported by a bootstrap value (BV) of 100%. Trochammina hadai is part of a clade that contains Srinivasania sundarbanensis, Eggerelloides scaber and Trochammina pacifica. The clade is not supported by bootstrap value. Three other clades are present in the tree. The second clade, also without BV support, consists of Textularia agglutinans, Siphoniferoides sp., Textularia gramen, Bigenerina sp. and Cyrea spp. A third clade without BV support contains Trochammina sp. and Spiroplectammina sp. A fourth clade contains Entzia macrescens, Entzia sp., Balticammina pseudomacrescens, Haplophragmoides wilberti and Arenoparrella mexicana and is highly supported by BV (93%). Liebusella goesi and Trochammina inflata are branching separately. Species represented by more than one sequence are well supported by BV (78–100%).

Figure 4. 

PhyML phylogenetic tree based on the 3’end fragment of the SSU rRNA gene, showing the evolutionary relationships of 49 agglutinated foraminiferal taxa. Specimens marked in bold indicate those for which sequences were acquired for the present study. The tree is rooted in Reophacidae (R. scorpiurus, R. spiculifer, R. curtus, R. pilulifera). Sequenced specimens are identified by their accession numbers. Numbers at nodes indicate bootstrap values (BV). Only BV larger than 70% are shown.

There were large differences in the relative abundances of Trochammina hadai along the coast of Normandy (Fig. 5). Subtidal stations in Le Havre and in the Caen Ouistreham (CO3) harbors exhibited the highest relative abundances between 20 and 34% (48±51–85±19 ind. 50 cm^-2, mean ± standard deviation). Conversely, T. hadai was barely found at the intertidal stations in the Orne estuary and in Le Havre harbor, and was completely absent in the Bay of Veys (Fig. 5). The indigenous T. inflata was only observed in the Bay of Veys at very low abundances (0.3–0.7%, 1±1 ind. 50 cm^-2).

Figure 5. 

Mean relative abundances (error bars: standard deviation) of living Trochammina hadai at sampling stations in Normandy.

Trochammina hadai was not found along the coast of the Hauts-de-France (Authie estuary, Boulogne, Calais and Dunkirk harbors) while few T. inflata specimens were recorded in the Authie estuary.

Until the present study, only three living benthic foraminiferal species from the Trochamminidae family were known to occur in the English Channel i.e. Trochammina inflata, Lepidodeuterammina ochracea (Williamson 1858) and L. eddystonensis (Brönnimann and Whittaker 1990) (see review in Armynot du Châtelet et al. 2018b). Morphological and molecular assessments of the Trochamminidae found along the coast of Normandy in the harbors of Le Havre and Caen-Ouistreham showed that they belong to T. hadai. Conversely, this species is not yet present farther north in the Hauts-de-France region. This work therefore represents the first known record of this species in European waters.

The natural range of distribution of Trochammina hadai is in Asia, specifically in Japan and Korea (Matsushita and Kitazato 1990; Lee et al. 2012; Lee et al. 2016). It usually flourishes in polluted or naturally stressed environments (Toyoda and Kitazato 1995; Lee et al. 2012), which may be considered as an ecological advantage over native species where it is introduced. This hypothesis is consistent with the polluted water of Le Havre Harbor (Hamdoun et al. 2015), where T. hadai exhibited high relative abundances up to 40%. The dominance of this NIS species in Caen-Ouistreham and Le Havre harbors suggests that this species is a strong competitor which most likely led to a significant shift in the foraminiferal community composition. Hence, T. hadai may be considered an invasive species in Normandy. The previous records of this species outside its native range of its distribution, in northwest America (McGann et al. 2000; McGann et al. 2012), Brazil (Eichler et al. 2018) and lately in Australia (Tremblin et al. 2022), consistently reported an invasive behavior. It is nevertheless stressed that T. hadai was only found in high abundances in heavily modified habitats in Normandy such as harbors. Only a few specimens were found outside harbors at the mouth of the Orne River. Though this may suggest an early stage of colonization or a limited potential for colonization outside highly polluted habitats, foraminiferal resting stages, i.e., propagules are nevertheless easily transported by currents (Alve and Goldstein 2003, 2010). Although speculative, this mean of dispersion is a way by which the invasive foraminifera T. hadai could extend its distribution from Normandy to the whole eastern English Channel, as it did from its point source in San Francisco Bay (McGann and Sloan 1996) before colonizing the whole United States West Coast (McGann et al. 2000). Regular surveys are then suggested as an absolute prerequisite to assess the future possible expansion of T. hadai in Normandy and farther in the eastern English Channel, as previously successfully implemented for other invasive species, in particular the crabs Hemigrapsus sanguineus and H. takanoi (Gothland et al. 2013; Gothland et al. 2014).

Apart from species deliberately introduced for aquaculture purposes, vectors of NIS introductions are ballast waters and/or ballast sediments, ship hull fouling, accidental releases associated to shellfish activities and ichthyochory (Carlton 1992; Gollasch 2002, 2006; Guy-Haim et al. 2017). It is noticeably not rare to find benthic foraminifera in ballast waters (McGann et al. 2003), which have subsequently often been mentioned as their major mean of introduction (Bouchet et al. 2007; Calvo-Marcilese and Langer 2010; Deldicq et al. 2019; McGann et al. 2019), especially compared to shellfish activities (McGann et al. 2000; Bouchet et al. 2007).

In the present study, Trochammina hadai specimens were essentially found in harbors exhibiting intense international shipping. Noticeably, Le Havre harbor is connected with about 650 harbors in all continents (Haropa Port 2022, Rapport d’activité 2021), and most of the NIS recorded in this harbor were introduced by ballast waters (Pezy et al. 2021). In agreement with previous records of T. hadai outside its natural range of distribution (McGann et al. 2000; Eichler et al. 2018; Tremblin et al. 2022), ballast waters are likely to be responsible for its introduction to harbors in Normandy. This hypothesis is consistent with the distribution pattern of T. hadai which is only found in Le Havre harbor in the area dedicated to international shipping, in sharp contrast with the part of the harbor dedicated to recreational boats which seems to be free of T. hadai. The exact country of origin remains uncertain. As explained above, Le Havre and Caen-Ouistreham harbors have international connections with all continents, noticeably Asia, South America, North America and Australia. As a result, it may be hypothesized that it could be a primary introduction directly from its natural range of distribution in Asia, or it could be a secondary spread from one of the areas where it has already been introduced and now proliferate such as in the United States, Brazil, or Australia. The molecular analyses performed in this study do not allow to choose between these two hypotheses. Noticeably, phylogenetic analyses of the small subunit (SSU) ribosomal DNA (rDNA) of rDNA nucleotide sequences in populations of T. hadai (18S) exhibited a low molecular genetic differentiation between the different populations, like previously observed in Virgulinella fragilis (Tsuchiya et al. 2009).

In the future, conducting a retrospective study based on fossil foraminifera would be relevant to determine when Trochammina hadai appeared in Normandy, like it was done for other NIS foraminifera (McGann et al. 2012; Polovodova Asteman and Schönfeld 2015; Deldicq et al. 2019; Stulpinaite et al. 2020). Further works are also required to understand from where it was introduced. This may be done through an assessment of the presence and nature of the benthic foraminifera present in ballast waters and associated sediments from incoming ships. Finally, because the identification of this Asiatic invasive foraminifera in Le Havre harbor was fortuitous, it emphasizes the need to implement a survey plan in French harbors in order to thoroughly track and document the presence of NIS, particularly in the context of the European marine strategic framework directive. Given the intense maritime traffic occurring between Europe and Asia or North/South America, T. hadai may likely be already present or is soon to be in other French/European harbors.