Research Article |
|
Corresponding author: Xavier Turon ( xturon@ceab.csic.es ) Corresponding author: José Carlos Hernández ( jocarher@ull.edu.es ) Academic editor: Noa Shenkar
© 2025 Xavier Turon, Marc Martín-Solà, Leopoldo Moro-Abad, José Carlos Hernández.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Turon X, Martín-Solà M, Moro-Abad L, Hernández JC (2025) Emergence of an invasive ascidian in Canary Islands (Eastern Atlantic): Tracking the arrival and spread of Cnemidocarpa irene. Aquatic Invasions 20(4): 411-425. https://doi.org/10.3391/ai.2025.20.4.172098
|
This study documents the first occurrence and rapid expansion of the solitary ascidian Cnemidocarpa irene in natural marine habitats of Tenerife (Canary Islands). Native to the Indo-Pacific, C. irene had previously been introduced to the Caribbean, Brazil, and Cape Verde. It was first observed in Tenerife in 2020, though retrospective records through citizen science tools date its presence back to 2018. A total of 74 sightings along the island’s coasts were reported between 2018 and 2024, when it reached densities of ca. 2 individuals/aggregates per square metre in the initial introduction area. Thus, the species is undergoing a clear proliferation and a spatial expansion. Morphological and genetic analyses confirmed the identity of C. irene and its phylogenetic placement, closely related to other Cnemidocarpa and related genera such as Asterocarpa. This species shows concerning invasive characteristics, such as a fast expansion, abundance in natural habitats, and aggregative behaviour, suggesting potential threats to native biota. Due to its limited natural dispersal capacity, the introduction of C. irene to Tenerife is attributed to anthropogenic vectors, particularly oil platforms arriving at major Canary Island ports. The proximity of the initial records to port areas supports this hypothesis. Given the potential species’ ecological risks, the authors recommend close monitoring, manual removal where feasible, and strengthened involvement of citizen science. This case highlights the vulnerability of oceanic islands to marine biological invasions and the importance of ports and marinas as critical entry points, underscoring the need for proactive surveillance and early intervention strategies.
Biological invasion, citizen science, DNA barcoding, taxonomy, tunicate
Non-indigenous species (NIS) are a major cause of ecological change in marine communities and one of the main threats to global biodiversity (
Oceanic islands in particular are well known models for biogeography and ecology studies. They are particularly sensitive to invasions by non-native species due to their high degree of endemism (
The Macaronesian region in the eastern Atlantic (including Azores, Madeira, Canary Islands and Cabo Verde archipelagos) has been the subject of some studies of marine NIS (e.g.,
Among marine invasive organisms, ascidians are an important group that includes species of major concern (
Invasive ascidians are commonly found on artificial substrates (
We describe here the recent arrival and expansion of a solitary ascidian previously unreported in the Canary Islands. This species is identified as Cnemidocarpa irene (Hartmeyer, 1906), an Indo-Pacific species that has been first introduced in the Caribbean, from where it expanded its range to Brazil and Cape Verde islands. The species can thrive in natural habitats and therefore poses a worrisome threat to native biota, warranting urgent monitoring.
The species was first documented during biodiversity assessments at shallow rocky reefs of Boca Cangrejo (coordinates: 28.406016 -16.314799, NE Tenerife Island, Fig.
Map of Tenerife (Canary Islands) with the total number of observations. The findings of Cnemidocarpa irene in the different areas (2018–2024) recorded in RedPROMAR are coloured according to the period of initial observations: red (2018–2019), orange (2020–2022), and green (2023–2024). Sourced from https://redpromar.org/home (accessed January 2025). Arrow points at the location of Boca Cangrejo, the initial point of detection, and where the abundance transects were performed. Circles mark the position of the main ports and marinas in the island. The bigger, colored one indicates the main commercial port of Santa Cruz. The other ports indicated (starting from Santa Cruz in a clockwise direction) are Radazul, Candelaria, Güímar, Granadilla, San Miguel, Las Galletas (southernmost port), Los Cristianos, Puerto Colón, Los Gigantes, and Garachico.
In addition, and in the framework of the citizen science platform RedPROMAR (https://redpromar.org), observations of the species have been recorded in recent years at various locations on the island of Tenerife (Fig.
All specimens examined were sampled at Boca Cangrejo, seven collected in January 2021 and eight in October 2021. Half the specimens were preserved in alcohol for genetic analyses, and the other half in formalin for morphological examination. The latter were dissected and examined under a stereomicroscope, and the cuticular lining of the siphons was excised to examine the siphonal spines with a light microscope.
A small piece (ca. 5–9 mm2) of the muscular mantle tissue of six individuals was extracted with REDExtract-N-Amp Tissue kit (Sigma-Aldrich), following manufacturer’s recommendations. A fragment of ca. 590 bp of the cytochrome oxidase I (COI) mitochondrial gene was amplified with the ascidian-specific primers Tun_forward 5’ TCGACTAATCATAAAGATATTAG 3’, and Tun_reverse2, 5’ AACTTGTATTTAAATTACGATC 3’ (
In order to place the new sequences in a phylogenetic context, we compiled a dataset of Styelidae COI sequences available in GenBank. We obtained sequences of all genera available with enough coverage (90% or above) of the sequenced region. We included representative species of these genera and, whenever possible, two sequences per species for a better clade sorting. We also downloaded all sequences from the genus Cnemidocarpa and, in the case of C. verrucosa, we obtained representatives of the two clades (spA and spB) recognized by
The aligned sequences were trimmed to a common length (536 bp) and checked with the modelTest function of the R package phangorn (
Cnemidocarpa irene is a solitary species of the family Styelidae. However, it is most often present in nature forming aggregates of 2–10 individuals. For simplicity, we will hereafter use “aggregates” as the abundance unit (albeit occasionally what we counted were single individuals). In the monitored point at Punta Cangrejo, the abundance of C. irene increased in little more than one year since first detection (August 2020) to values over 1 aggregate per square meter. Four years after arrival, it reached densities of 1.9 aggregates*m-2 in December of 2024 (Fig.
After identification of the species in 2021, we could in retrospect identify some observations previously registered at the RedPROMAR citizen science platform (RedPROMAR 2025), but as yet unassigned. The identification was based on pictures of individuals matching the general appearance of the species and in which the siphons are open and their typical aspect (see below) could be ascertained. This pushed back C. irene’s arrival in Tenerife to 2018 (Fig.
The synonymy of the species is complicated (see Discussion), and detailed morphological descriptions are necessary to verify the taxonomic status of any new finding. Thus, we aim here to provide a comprehensive account of the external and internal morphology of the specimens collected.
The individuals measure up to 5 cm in maximal dimension. The tunic is reddish to orange in live specimens (turning brown in fixative) (Fig.
In situ images of Cnemidocarpa irene. A–C underwater pictures of the species, note variable cover by epibionts (the colonial ascidian Symplegma sp in A); D an aggregation of individuals; E individual hitchhiking a sponge crab (Dromia sp.); F detail of the oral siphon of another individual. Photo Credit: A–E Marc Martín-Solà; F Leopoldo Moro-Abad.
The tunic is consistent but not coriaceous, it has an inner whitish layer and the mantle is easily separated from it. The mantle is dark-brown, weakly muscular, and allows the gonads to be seen from outside (Fig.
Anatomical details of Cnemidocarpa irene. A, B right and left view of the mantle of an individual; C dissected mantle of another specimen, branchial sac retired; D section of the stomach showing internal ridges; E, F images of the apertures of the neural gland of two individuals; G detail of the branchial mesh between folds; H enlarged view of the atrial siphon (as) zone, showing the distal end of four gonads on the right body side and two on the left (asterisks), anus (a), and esophagus (e). Arrowheads point to filiform tentacles at the base of the atrial velum; I detail of the distal end of one gonad, showing sperm ducts (arrowheads) joining a common duct that runs along the length of the gonad (asterisks). Male and female papillae are shown. Photo credit: Xavier Turon. Scale bars: 1 cm (A–C); 5 mm (D); 1 mm (E–G); 5 mm (H); 1 mm (I).
The oral siphon is lined by a variable number (20–30) of simple tentacles (Fig.
Right: Dorsal lamina-5-(14)-7-(18)-5-(13)-5-(14)-5-Endostyle
Left: Dorsal lamina-7-(12)-5-(14)-5-(13)-5-(14)-5-Endostyle
There are up to 7–10 stigmata in a branchial mesh (Fig.
The digestive system forms a closed loop, with the ascending and descending branches of the gut close together (Fig.
The gonads are elongated and tubular, in variable numbers. We have found generally four (sometimes three) on the right side, but often some of them are bifurcated (one gonad divides distally in two branches) or two gonads are fused distally (e.g., Fig.
There are a few endocarps interspersed with the gonads on the right side of the body, but they are more frequent both inside the gut loop and following the outer margin of the intestine curve (Fig.
We obtained 4 different haplotypes from the 6 individuals sequenced (H1, H2, H3: one individual each; H4: three individuals). The sequences have been deposited in GenBank (accession numbers: PV849603 to PV849606). Sequence identities between them ranged from 0.917 to 0.984, being H2 the most divergent with respect to the other three haplotypes. They were added to a database of 48 sequences of Styelidae encompassing 14 genera (Suppl. material
Maximum likelihood tree of the Styelidae dataset. For each branch, GenBank accession number and species name (as in Suppl. material
It can be seen that the four haplotypes obtained formed a monophyletic clade with high bootstrap support. In turn, this clade joins the one formed by 4 sequences of Cnemidocarpa verrucosa and 2 of Asterocarpa humilis (each species forming a separate clade). The sister clade to this group includes the five Styela species in the dataset. It is noteworthy that the only other Cnemidocarpa sequence included, C. finmarkiensis, was rather divergent from the ones in the Cnemidocarpa + Asterocarpa clade, forming part of an unresolved polytomy.
The specimens studied match previous descriptions of Cnemidocarpa irene, in particular the detailed ones of
Although detailed morphological examination is essential for the reliable identification of ascidian species, it is not feasible for all sightings, particularly those reported through citizen science platforms that rely primarily on photographs. Therefore, diagnostic characters based on external features are desirable. In C. irene, aside from overall shape and coloration, the inner siphonal pattern can serve as a useful diagnostic trait, as the marbled appearance and coloration of the siphons are distinctive. Many Styelidae and Pyuridae, groups that include similarly sized solitary ascidians, exhibit a marked pattern of longitudinal bands in the siphons. A potential source of confusion is Pyura herdmani, which has similarly marbled inner siphonal linings, occurs in NW Africa, and has recently been introduced to Europe (
Cnemidocarpa irene was described from Japan (
In the eastern Atlantic it was first reported in Cape Verde in 1990 by
The genetic results show that the sequences obtained formed a robust clade, which in turn groups with that of C. verrucosa and Asterocarpa humilis. The latter was initially placed in the genus Cnemidocarpa, until the new genus Asterocarpa was described (
Given the reduced natural dispersal abilities of the short-lived larval stage of ascidians (
As the introduction is recent, it is not possible to ascertain its effects on local communities. While aggregates formed by C. irene may provide substrate for other species, they can also compete for food and space with the native biota and have detrimental effects, especially if they reach high abundances as the increasing trend observed suggests. Given the current extent of C. irene proliferation in Tenerife, eradication of the species is no longer a realistic goal; it may have been feasible only at the onset of its introduction (likely in 2018 or shortly before). At present, mitigation measures such as manual removal are only practical when newly colonizing individuals are detected early upon arrival at a locality. To be able to identify these early stages of introduction, a close monitoring is necessary, particularly in and near harbours and marinas. The help of local citizens and diving clubs can prove invaluable in this respect. This case highlights the vulnerability of oceanic islands to marine biological invasions, underscoring the need for proactive surveillance and early intervention strategies.
This research was partially financed by project BlueDNA (PID2023-146307OB), funded by the Spanish Ministry of Science, Innovation, and Universities (MICIU/AEI/10.13039/501100011033) and by ERDF/EU.
All authors, study conceptualization and design; LMA, JCH, MMS, data collection; LMA, MMS, underwater photographs; JCH, LMA, MMS, time series analyses; XT, morphology and genetic analyses, original draft; JCH, XT, funding; All authors, draft review and editing. We also acknowledge the contributions of two anonymous reviewers.
The authors acknowledge the collaboration of all anonymous citizens that participated in the RedPROMAR initiative. We are also grateful to the comments by two anonymous reviewers that improved our manuscript.
Alignment of the sequences used in the phylogeny reconstruction
Data type: fas
Explanation note: GenBank accession numbers are indicated.