Research Article
Print
Research Article
Emergence of an invasive ascidian in Canary Islands (Eastern Atlantic): Tracking the arrival and spread of Cnemidocarpa irene
expand article infoXavier Turon, Marc Martín-Solà§|, Leopoldo Moro-Abad, José Carlos Hernández§
‡ Centre for Advanced Studies of Blanes, Girona, Spain
§ Universidad de La Laguna, Tenerife, Spain
| Gestión y Planeamiento Territorial y Medioambiental, Tenerife, Spain
¶ Servicio de Biodiversidad, Gobierno de Canarias, Santa Cruz de Tenerife, Spain
Open Access

Abstract

This study documents the first occurrence and rapid expansion of the solitary ascidian Cnemidocarpa irene in natural marine habitats of Tenerife (Canary Islands). Native to the Indo-Pacific, C. irene had previously been introduced to the Caribbean, Brazil, and Cape Verde. It was first observed in Tenerife in 2020, though retrospective records through citizen science tools date its presence back to 2018. A total of 74 sightings along the island’s coasts were reported between 2018 and 2024, when it reached densities of ca. 2 individuals/aggregates per square metre in the initial introduction area. Thus, the species is undergoing a clear proliferation and a spatial expansion. Morphological and genetic analyses confirmed the identity of C. irene and its phylogenetic placement, closely related to other Cnemidocarpa and related genera such as Asterocarpa. This species shows concerning invasive characteristics, such as a fast expansion, abundance in natural habitats, and aggregative behaviour, suggesting potential threats to native biota. Due to its limited natural dispersal capacity, the introduction of C. irene to Tenerife is attributed to anthropogenic vectors, particularly oil platforms arriving at major Canary Island ports. The proximity of the initial records to port areas supports this hypothesis. Given the potential species’ ecological risks, the authors recommend close monitoring, manual removal where feasible, and strengthened involvement of citizen science. This case highlights the vulnerability of oceanic islands to marine biological invasions and the importance of ports and marinas as critical entry points, underscoring the need for proactive surveillance and early intervention strategies.

Key words:

Biological invasion, citizen science, DNA barcoding, taxonomy, tunicate

Introduction

Non-indigenous species (NIS) are a major cause of ecological change in marine communities and one of the main threats to global biodiversity (Dukes and Mooney 1999; Bax et al. 2003; McGeoch et al. 2010). Assessing the initial stages of any introduction is key to allow prompt management and to ascertain the introduction dynamics and forecast potential spread. However, this information is lacking for most known introductions and subsequent invasions in the marine environment.

Oceanic islands in particular are well known models for biogeography and ecology studies. They are particularly sensitive to invasions by non-native species due to their high degree of endemism (Sax and Gaines 2008). While terrestrial introductions in insular systems have been extensively studied as models in invasion science (e.g., Simberloff 1995; Lenzner et al. 2020), much less is known on the effects of marine invasions on islands, with Pacific archipelagos being the most studied so far (e.g., Paulay et al. 2002; Inglis et al. 2006; Carlton and Eldredge 2015).

The Macaronesian region in the eastern Atlantic (including Azores, Madeira, Canary Islands and Cabo Verde archipelagos) has been the subject of some studies of marine NIS (e.g., Canning-Clode et al. 2013; Chainho et al. 2015; Pajuelo et al. 2016). In a recent review of Macaronesian marine non-native species (Castro et al. 2022), the Canary Islands have been signalled as a hotspot for introductions compared to nearby archipelagos, and this is attributable to the intense shipping activity, touristic pressure involving a dense network of marinas, oil drill settings, and aquaculture activities, among others. Over 110 marine NIS have been reported in the Canary Islands (https://www.biodiversidadcanarias.es/exos, accessed 21 December 2024).

Among marine invasive organisms, ascidians are an important group that includes species of major concern (Lambert 2001, 2007), some of which have worldwide colonisation ranges (Lambert 2007; Zhan et al. 2015). They are sessile marine filter feeders with some characteristics suitable for successful colonisation: rapid growth rate and short time to maturity (Rius et al. 2009; Pineda et al. 2013; Casso et al. 2018), physical and chemical defences (Stoecker 1980; López-Legentil et al. 2006), and the production of a large number of short-lived non-feeding planktonic larvae (Lambert 2001). In the Canary Islands, the presence of nearly 50 new ascidians has been recorded over the past 10 years (https://www.biodiversidadcanarias.es/exos; Martín-Solà et al. 2022).

Invasive ascidians are commonly found on artificial substrates (Tyrrell and Byers 2007) which makes them one of the main fouling groups in marinas, aquaculture facilities and other human-built structures (Airoldi et al. 2015). There are, however, some cases of ascidian invasions of natural benthic communities, where they can aggressively overgrow epibenthic communities and cover large areas of the seafloor. Some prominent instances are Didemnum vexillum in the NE American coast (Bullard et al. 2007; Kaplan et al. 2018), Pyura praeputialis in Chile (Castilla et al. 2004), or Distaplia stylifera in Baja California (Moreno-Dávila et al. 2023).

We describe here the recent arrival and expansion of a solitary ascidian previously unreported in the Canary Islands. This species is identified as Cnemidocarpa irene (Hartmeyer, 1906), an Indo-Pacific species that has been first introduced in the Caribbean, from where it expanded its range to Brazil and Cape Verde islands. The species can thrive in natural habitats and therefore poses a worrisome threat to native biota, warranting urgent monitoring.

Methods

Abundance and distribution

The species was first documented during biodiversity assessments at shallow rocky reefs of Boca Cangrejo (coordinates: 28.406016 -16.314799, NE Tenerife Island, Fig. 1) in August 2020. This locality is a natural environment, hotspot for diving and recreational activities, located 11 Km south of the island’s main port hub in the capital, Santa Cruz. No individuals had been observed in July of the same year at Boca Cangrejo. A follow-up was performed at this locality during 2020–2021 to monitor its initial spread. A further tally was done at the end of 2024. All assessments were made by deploying 3 to 5 transects (10 × 2 metres) between 2 and 5 m of depth and counting the number of individuals or aggregates found.

Figure 1. 

Map of Tenerife (Canary Islands) with the total number of observations. The findings of Cnemidocarpa irene in the different areas (2018–2024) recorded in RedPROMAR are coloured according to the period of initial observations: red (2018–2019), orange (2020–2022), and green (2023–2024). Sourced from https://redpromar.org/home (accessed January 2025). Arrow points at the location of Boca Cangrejo, the initial point of detection, and where the abundance transects were performed. Circles mark the position of the main ports and marinas in the island. The bigger, colored one indicates the main commercial port of Santa Cruz. The other ports indicated (starting from Santa Cruz in a clockwise direction) are Radazul, Candelaria, Güímar, Granadilla, San Miguel, Las Galletas (southernmost port), Los Cristianos, Puerto Colón, Los Gigantes, and Garachico.

In addition, and in the framework of the citizen science platform RedPROMAR (https://redpromar.org), observations of the species have been recorded in recent years at various locations on the island of Tenerife (Fig. 1). REDPROMAR is a network set up by the Canary Islands Government for the monitoring and surveillance of marine life in the Archipelago. Anyone can register and upload sightings, which must be accompanied by a precise location, date, and a picture of the organism. Sightings are validated by a team of specialists in various taxonomic groups.

Taxonomic observation

All specimens examined were sampled at Boca Cangrejo, seven collected in January 2021 and eight in October 2021. Half the specimens were preserved in alcohol for genetic analyses, and the other half in formalin for morphological examination. The latter were dissected and examined under a stereomicroscope, and the cuticular lining of the siphons was excised to examine the siphonal spines with a light microscope.

Genetic analyses

A small piece (ca. 5–9 mm2) of the muscular mantle tissue of six individuals was extracted with REDExtract-N-Amp Tissue kit (Sigma-Aldrich), following manufacturer’s recommendations. A fragment of ca. 590 bp of the cytochrome oxidase I (COI) mitochondrial gene was amplified with the ascidian-specific primers Tun_forward 5’ TCGACTAATCATAAAGATATTAG 3’, and Tun_reverse2, 5’ AACTTGTATTTAAATTACGATC 3’ (Stefaniak et al. 2009). PCR amplification was done in 20 µL total reaction volume with 10 µL of REDExtract-N-Amp PCR reaction mix (Sigma-Aldrich), 0.8 µL (10 mM) of each primer, 6.4 µL of ultra-pure water (Sigma-Aldrich) and 2 µL of DNA at a concentration of ca. 5 ng/µL. PCR followed an initial denaturation at 94 °C for 5 min, 35 cycles of a denaturation step at 94 °C for 1 min, an annealing step at 50 °C for 1 min, an elongation step at 72 °C for 1 min, and a final elongation step at 72 °C for 7 min. The amplified DNA was purified with Exo-SAP. Sequencing was carried out (both strands) at Macrogen facilities (Netherlands). The resulting sequences were assembled, edited and aligned in BioEdit v.7.2.6 (Hall 1999). The final alignment length was 584 bp.

In order to place the new sequences in a phylogenetic context, we compiled a dataset of Styelidae COI sequences available in GenBank. We obtained sequences of all genera available with enough coverage (90% or above) of the sequenced region. We included representative species of these genera and, whenever possible, two sequences per species for a better clade sorting. We also downloaded all sequences from the genus Cnemidocarpa and, in the case of C. verrucosa, we obtained representatives of the two clades (spA and spB) recognized by Ruiz et al. (2020). Three unpublished sequences of Cnemidocarpa in GenBank, two identified as C. areolata (a synonym of C. irene, see Discussion) with accession numbers KX138515 and KX138514, and a Cnemidocarpa sp. (KX650767), were not included in the final dataset. The three of them were > 90% similar, but blast searches of these sequences showed a low similarity with any other ascidian. The best hits were ca. 78% similarity with a Pyuridae (Microcosmus squamiger) and with a Styelidae (Botrylloides sp.). Similarities with all other Styelidae sequences in the dataset had a mean of 72.8%. As there is no publication and we could not verify their identity, we considered these divergent sequences as being misidentified.

The aligned sequences were trimmed to a common length (536 bp) and checked with the modelTest function of the R package phangorn (Schliep 2011) to select the best-fit evolutionary model of nucleotide substitution based on the Akaike Information Criterion (AIC). This model was then selected in a maximum likelihood tree search in Mega X (Kumar et al. 2018) with default options and 100 bootstrap replicates. A sequence of the pyurid Halocynthia papillosa was used as an outgroup. A fasta file with the alignment is provided as Suppl. material 1.

Results

Abundance and distribution

Cnemidocarpa irene is a solitary species of the family Styelidae. However, it is most often present in nature forming aggregates of 2–10 individuals. For simplicity, we will hereafter use “aggregates” as the abundance unit (albeit occasionally what we counted were single individuals). In the monitored point at Punta Cangrejo, the abundance of C. irene increased in little more than one year since first detection (August 2020) to values over 1 aggregate per square meter. Four years after arrival, it reached densities of 1.9 aggregates*m-2 in December of 2024 (Fig. 2).

Figure 2. 

Cnemidocarpa irene abundance trend at Boca Cangrejo site for 2020–2024. Photo credit: Antonio de la Rosa.

After identification of the species in 2021, we could in retrospect identify some observations previously registered at the RedPROMAR citizen science platform (RedPROMAR 2025), but as yet unassigned. The identification was based on pictures of individuals matching the general appearance of the species and in which the siphons are open and their typical aspect (see below) could be ascertained. This pushed back C. irene’s arrival in Tenerife to 2018 (Fig. 1). Since that year, in the Canary Islands, this species has only been observed on Tenerife. The first records in the platform (2018–2019) were located in the northeastern part of the island. Subsequently (2020–2022), additional sightings were recorded at other locations along the eastern coast. In recent years (2023–2024), sightings have also been reported along the southern and western coasts. In total, 74 sightings have been documented on the RedPROMAR platform during this period (Fig. 1).

Morphological description

The synonymy of the species is complicated (see Discussion), and detailed morphological descriptions are necessary to verify the taxonomic status of any new finding. Thus, we aim here to provide a comprehensive account of the external and internal morphology of the specimens collected.

The individuals measure up to 5 cm in maximal dimension. The tunic is reddish to orange in live specimens (turning brown in fixative) (Fig. 3A–E). The siphons are distinctive, with the inner surface covered by a velum extending almost to the siphon rim. This gives the inner siphons a marbled appearance, predominantly whitish, yellowish or greenish in tone. In some specimens, the inner surface of the siphons is darker, brown to reddish, featuring yellow-green patches (Fig. 3F). Scale-like spines (20 µm in width) are present in the upper inner tunic of the siphons, but they are few and hard to observe. The tunic surface ranges from near-smooth to rough with tubercles of several sizes. The ascidians are covered by other epibionts, mainly algae species. However, when individuals are found in areas with sea urchins they are cleaner than otherwise, likely due to the effect of sea urchin grazing upon epibionts. The ascidians are fixed ventrally and posteriorly, and the intersiphonal distance is ca. half the total tunic length. It is not uncommon to see individuals on the carapace of sponge crabs (Dromia spp., Fig. 3E).

Figure 3. 

In situ images of Cnemidocarpa irene. A–C underwater pictures of the species, note variable cover by epibionts (the colonial ascidian Symplegma sp in A); D an aggregation of individuals; E individual hitchhiking a sponge crab (Dromia sp.); F detail of the oral siphon of another individual. Photo Credit: A–E Marc Martín-Solà; F Leopoldo Moro-Abad.

The tunic is consistent but not coriaceous, it has an inner whitish layer and the mantle is easily separated from it. The mantle is dark-brown, weakly muscular, and allows the gonads to be seen from outside (Fig. 4A, B).

Figure 4. 

Anatomical details of Cnemidocarpa irene. A, B right and left view of the mantle of an individual; C dissected mantle of another specimen, branchial sac retired; D section of the stomach showing internal ridges; E, F images of the apertures of the neural gland of two individuals; G detail of the branchial mesh between folds; H enlarged view of the atrial siphon (as) zone, showing the distal end of four gonads on the right body side and two on the left (asterisks), anus (a), and esophagus (e). Arrowheads point to filiform tentacles at the base of the atrial velum; I detail of the distal end of one gonad, showing sperm ducts (arrowheads) joining a common duct that runs along the length of the gonad (asterisks). Male and female papillae are shown. Photo credit: Xavier Turon. Scale bars: 1 cm (A–C); 5 mm (D); 1 mm (E–G); 5 mm (H); 1 mm (I).

The oral siphon is lined by a variable number (20–30) of simple tentacles (Fig. 4C) arising from a short membrane with a denticulate margin. The pericoronal area is narrow, and the aperture of the neural gland is U-shaped with horns more or less rolled (Fig. 4E, F). The branchial sac has four folds on each side that are well separated and do not overlap. The dorsal lamina is simple and low. The branchial formula varies among individuals, but for a 4.5 cm specimen at the posterior part of the branchial sac it was:

Right: Dorsal lamina-5-(14)-7-(18)-5-(13)-5-(14)-5-Endostyle

Left: Dorsal lamina-7-(12)-5-(14)-5-(13)-5-(14)-5-Endostyle

There are up to 7–10 stigmata in a branchial mesh (Fig. 4G), and parastigmatic vessels are sometimes present, particularly near the dorsal lamina.

The digestive system forms a closed loop, with the ascending and descending branches of the gut close together (Fig. 4C). The secondary loop is wide open. The digestive system does not reach the posterior end of the body, leaving a free space. The stomach is sac-like with a smooth outer surface, although internally there are up to 20 laminar plications (Fig. 4D). The anus is multi-lobed and opens near the atrial siphon (Fig. 4H). In this same area open the gonoducts, and a ring of filiform tentacles is present at the basis of the atrial velum (Fig. 4H).

The gonads are elongated and tubular, in variable numbers. We have found generally four (sometimes three) on the right side, but often some of them are bifurcated (one gonad divides distally in two branches) or two gonads are fused distally (e.g., Fig. 4C). On the left side there are generally two (sometimes three) gonads, anterior to the digestive loop. The gonads have the male follicles in the lower (mantle-wise) part, while the upper (branchial-wise) portion contains the oocytes. In all cases the gonads were ripe (samples examined were from January and October). The sperm ducts from the male follicles surround the oocyte mass and join in the upper part of the gonad into a common sperm duct that runs the length of the gonad until the distal male papilla situated just above the female opening (Fig. 4I).

There are a few endocarps interspersed with the gonads on the right side of the body, but they are more frequent both inside the gut loop and following the outer margin of the intestine curve (Fig. 4C).

Genetic analyses

We obtained 4 different haplotypes from the 6 individuals sequenced (H1, H2, H3: one individual each; H4: three individuals). The sequences have been deposited in GenBank (accession numbers: PV849603 to PV849606). Sequence identities between them ranged from 0.917 to 0.984, being H2 the most divergent with respect to the other three haplotypes. They were added to a database of 48 sequences of Styelidae encompassing 14 genera (Suppl. material 1). The modelTest function revealed that the best-fit model of nucleotide selection for this dataset was the General Time Reversible model with a gamma distributed rate variation among sites and a proportion of invariable sites (GTR+G+I). This model was input in the ML algorithm of Mega and the corresponding phylogenetic tree obtained is depicted in Fig. 5 (G parameter = 0.731, I parameter = 43.76%).

Figure 5. 

Maximum likelihood tree of the Styelidae dataset. For each branch, GenBank accession number and species name (as in Suppl. material 1) is provided. Numbers in main branches indicate bootstrap support values (when > 50%). For Cnemidocarpa verrucosa, the two clades (spA and spB) identified by Ruiz et al. (2020) are indicated. The same was done for the two clades of Styela plicata named Group1 and Group2 in Pineda et al. (2011). Sequences obtained in this study are indicated in red.

It can be seen that the four haplotypes obtained formed a monophyletic clade with high bootstrap support. In turn, this clade joins the one formed by 4 sequences of Cnemidocarpa verrucosa and 2 of Asterocarpa humilis (each species forming a separate clade). The sister clade to this group includes the five Styela species in the dataset. It is noteworthy that the only other Cnemidocarpa sequence included, C. finmarkiensis, was rather divergent from the ones in the Cnemidocarpa + Asterocarpa clade, forming part of an unresolved polytomy.

Discussion

The specimens studied match previous descriptions of Cnemidocarpa irene, in particular the detailed ones of Monniot (1983, as C. areolata), Nishikawa (1991), Rocha et al. (2012), and Monniot (2018). It should be noted that the synonymy of the species is complicated, as discussed by Monniot and Monniot (1984) and Nishikawa (1991). C. irene is a species found from shallow waters to deep sea (Monniot 2021), and is a cause of concern for its invasive potential (Locke 2009; Monniot 2018). Punta Cangrejo, the locality of the first sightings and where the highest densities of the species have been found, is located a few kilometres south of the main port of Santa Cruz, in an area with predominantly southward currents. Thus, it is likely that the species first entered the island via the commercial hub of its capital.

Although detailed morphological examination is essential for the reliable identification of ascidian species, it is not feasible for all sightings, particularly those reported through citizen science platforms that rely primarily on photographs. Therefore, diagnostic characters based on external features are desirable. In C. irene, aside from overall shape and coloration, the inner siphonal pattern can serve as a useful diagnostic trait, as the marbled appearance and coloration of the siphons are distinctive. Many Styelidae and Pyuridae, groups that include similarly sized solitary ascidians, exhibit a marked pattern of longitudinal bands in the siphons. A potential source of confusion is Pyura herdmani, which has similarly marbled inner siphonal linings, occurs in NW Africa, and has recently been introduced to Europe (Rius et al. 2024). However, individuals of this species are much larger (up to 30 cm) than those of C. irene. For this and other solitary ascidian species, it is strongly recommended that citizen science practitioners obtain underwater pictures of individuals with their siphons wide open to capture the characteristic colour patterns.

Cnemidocarpa irene was described from Japan (Hartmeyer 1906) and is common in the Indo-West Pacific region (Kott 1985, as C. areolata, Rho and Park 1998; Monniot and Monniot 2003; Locke 2009; Lambert et al. 2021), but in the western Atlantic it had only been reported for the Caribbean (Monniot 1983, as C. areolata; Monniot and Monniot 1984, as C. valborg). Monniot (1983) indicated that it had likely been introduced in the Caribbean, and the species has been recently reported as introduced to Brazilian waters (Rocha et al. 2012, 2024; Dias et al. 2013; Granthom-Costa et al. 2025).

In the eastern Atlantic it was first reported in Cape Verde in 1990 by Monniot and Monniot (1994), albeit these authors noted also that the species C. maroccana may be instead C. irene, in which case there would also be a report in Morocco, pushing back in time the presence of the species in the eastern Atlantic. The type specimen being lost, this fact remains unverifiable (Monniot and Monniot 1994).

The genetic results show that the sequences obtained formed a robust clade, which in turn groups with that of C. verrucosa and Asterocarpa humilis. The latter was initially placed in the genus Cnemidocarpa, until the new genus Asterocarpa was described (Brewin 1946). Both genera are closely related (Kott 1985), and are distinguished on the basis of a different gonad arrangement, albeit this separation is not accepted by some authors (Monniot et al. 2001). Our genetic results did not support the establishment of a separate Asterocarpa genus. The closest clade to the Cnemidocarpa + Asterocarpa one comprises the species of Styela, a genus closely related to Cnemidocarpa also on morphological grounds (Kott 1985). On the other hand, the nature of the rather divergent sequence of C. finmarkiensis surely deserves more studies with taxonomically verified material and more sequences. Albeit COI lacks resolution to establish a reliable phylogeny, the results obtained with this dataset confirm the placement of our sequences in the genus Cnemidocarpa and agree in some aspects (such as the polyphyly of Polyandrocarpa and Polycarpa) with more detailed phylogenomic analyses (Alié et al. 2018).

Given the reduced natural dispersal abilities of the short-lived larval stage of ascidians (Svane and Young 1989; Lambert 2001), the arrival of C. irene to the Canary Islands is attributable to anthropogenic transport. There are several potential mechanisms, from plastic trash rafting to oil platforms that can move entire benthic and fouling communities. However, oil platforms have been recently highlighted to be one of the most important introduction vectors in the Canary Islands to explain the massive exotic fish species arrivals of the last two decades, which has coincided in time with an increase of oil platform arrivals (Pajuelo et al. 2016; Falcón et al. 2023) to Santa Cruz in Tenerife and Las Palmas in Gran Canaria, the main harbours of these islands. The exotic communities mainly come from tropical regions of the eastern Atlantic and the Gulf of Guinea. However, Canary Islands also receive platforms from western tropical Atlantic regions such as Brazil, the Caribbean. Finally, a few rigs have been transported from the Indo-Pacific region. These movements imply that large ports, particularly those receiving oil platforms, are hotspots for non-indigenous species and, at the same time, priority areas for the early detection and management prior to the spread of potential marine biological invasions (Lehtiniemi et al. 2015; Romeo et al. 2015; Tempesti et al. 2020). The presence of C. irene was traced back to 2018, and in the shallow natural environment. These initial records and the majority of C. irene sightings reported on the RedPROMAR platform were concentrated in the northeastern part of the island (RedPROMAR 2025), near the port area of Santa Cruz de Tenerife, the main maritime hub of the island. After the identification of C. irene, its presence has also been noted in harbours of the island (Martín-Solà, pers obs), where it had likely been previously overlooked, so an initial date of introduction in harbours cannot be determined at present.

As the introduction is recent, it is not possible to ascertain its effects on local communities. While aggregates formed by C. irene may provide substrate for other species, they can also compete for food and space with the native biota and have detrimental effects, especially if they reach high abundances as the increasing trend observed suggests. Given the current extent of C. irene proliferation in Tenerife, eradication of the species is no longer a realistic goal; it may have been feasible only at the onset of its introduction (likely in 2018 or shortly before). At present, mitigation measures such as manual removal are only practical when newly colonizing individuals are detected early upon arrival at a locality. To be able to identify these early stages of introduction, a close monitoring is necessary, particularly in and near harbours and marinas. The help of local citizens and diving clubs can prove invaluable in this respect. This case highlights the vulnerability of oceanic islands to marine biological invasions, underscoring the need for proactive surveillance and early intervention strategies.

Funding

This research was partially financed by project BlueDNA (PID2023-146307OB), funded by the Spanish Ministry of Science, Innovation, and Universities (MICIU/AEI/10.13039/501100011033) and by ERDF/EU.

Authors contribution

All authors, study conceptualization and design; LMA, JCH, MMS, data collection; LMA, MMS, underwater photographs; JCH, LMA, MMS, time series analyses; XT, morphology and genetic analyses, original draft; JCH, XT, funding; All authors, draft review and editing. We also acknowledge the contributions of two anonymous reviewers.

Acknowledgments

The authors acknowledge the collaboration of all anonymous citizens that participated in the RedPROMAR initiative. We are also grateful to the comments by two anonymous reviewers that improved our manuscript.

References

  • Airoldi L, Turon X, Perkol-Finkel S, Rius M (2015) Corridors for aliens but not for natives: effects of marine urban sprawl at a regional scale. Diversity and Distributions 21: 755–768. https://doi.org/10.1111/ddi.12301
  • Alié A, Hiebert LS, Simion P, Scelzo M, Prünster MM, Lotito S, Delsuc F, Douzery E, Dantec C, Lemaire P, Darras S, Kawamura K, Brown D, Tiozzo S (2018) Convergent acquisition of nonembryonic development in styelid ascidians. Molecular Biology and Evolution 35: 1728–1743. https://doi.org/10.1093/molbev/msy068
  • Brewin BI (1946) Ascidians in the vicinity of the Portobello Marine Biological Station, Otago Harbour. Transactions of the Royal Society of New Zealand 76: 87–131.
  • Bullard SG, Lambert G, Carman MR, Byrnes J, Whitlatch RB, Ruiz G, Miller RJ, Harris L, Valentine PC, Collie JS, Pederson J, McNaught DC, Cohen AN, Asch RG, Dijkstra JA, Heinonen K (2007) The colonial ascidian Didemnum sp. A: Current distribution, basic biology and potential threat to marine communities of the northeast and west coasts of North America. Journal of Experimental Marine Biology and Ecology 342: 99–108. https://doi.org/10.1016/j.jembe.2006.10.020
  • Canning-Clode J, Fofonoff G, McCann L, Carlton JT, Ruiz G (2013) Marine invasions on a subtropical island: Fouling studies and new records in a recent marina on Madeira Island (Eastern Atlantic Ocean). Aquatic Invasions 8: 261–270. https://doi.org/10.3391/ai.2013.8.3.02
  • Carlton JT, Eldredge LG (2015) Update and revisions of the marine bioinvasions of Hawai’i: The introduced and cryptogenic marine and estuarine animals and plants of the Hawaiian Archipelago. Bishop Museum Bulletin in Zoology 9: 25–47.
  • Casso M, Navarro M, Ordóñez V, Fernandez-Tejedor M, Pascual M, Turon X (2018) Seasonal patterns of settlement and growth of introduced and native ascidians in bivalve cultures in the Ebro Delta (NE Iberian Peninsula). Regional Studies in Marine Science 23: 12–22. https://doi.org/10.1016/j.rsma.2017.11.002
  • Castilla JC, Guiñez R, Caro AU, Ortiz V (2004) Invasion of a rocky intertidal shore by the tunicate Pyura praeputialis in the Bay of Antofagasta, Chile. Proceedings of the National Academy of Sciences 101: 8517–8524. https://doi.org/10.1073/pnas.0401921101
  • Castro N, Carlton JT, Costa AC, Marques CS, Hewill CL, Cacabelos E, Lopes E, Gizzi F, Gestoso I, Monteiro JG, Costa JL, Parente M, Ramalhosa P, Fofonoff P, Chainho P, Haroun R, Santos RS, Herrera R, Marques TA, Ruiz GM, Canning-Clode J (2022) Diversity and patterns of marine non-native species in the archipelagos of Macaronesia. Diversity and Distributions 28: 667–684. https://doi.org/10.1111/ddi.13465
  • Chainho P, Fernandes A, Amorim A, Ávila SP, Canning-Clode J, Castro JJ, Costa AC, Costa JL, Cruz T, Gollasch S, Grazziotin-Soares C, Melo R, Micael J, Parente MI, Semedo J, Silva T, Sobral D, Sousa M, Torres P, Veloso V, Costa MJ (2015) Non-indigenous species in Portuguese coastal areas, coastal Lagoons, estuaries and islands. Estuarine, Coastal and Shelf Science 167: 199–211. https://doi.org/10.1016/j.ecss.2015.06.019
  • Dias GM, Rocha RM, Lotufo TMC, Kremer LP (2013) Fifty years of ascidian biodiversity research in Sao Sebastiao, Brazil. Journal of the Biological Association of the United Kingdom 93: 273–282. https://doi.org/10.1017/S002531541200063X
  • Falcón JM, Brito A, Herrera R, Ayza O, Moro L, Caro MB (2023) Peces marinos tropicales exóticos de Canarias. Ed: Consejería de Transición Ecológica, Lucha contra el Cambio Climático y Planificación Territorial del Gobierno de Canarias, Las Palmas, 252 pp.
  • Granthom-Costa LV, de Messano LVR, Altvater L, Spotorno P, Coutinho R (2025) Non-native marine sessile benthic species from the coastal upwelling ecosystem of Arraial do Cabo, Brazil. Aquatic Invasions 20: 181–198. https://doi.org/10.3391/ai.2025.20.2.147751
  • Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Hartmeyer R (1906) Ein beitrag zur kenntnis der japanischen Ascidienfauna. Zoologischer Anzeiger 31(1): 1–30.
  • Inglis GJ, Hayden BJ, Nelson WA (2006) Are the marine biotas of island ecosystems more vulnerable to invasion? In: Allen RB, Lee WG (Eds) Biological invasions in New Zealand, Springer, 119–135. https://doi.org/10.1007/3-540-30023-6_8
  • Kaplan KA, Hart DR, Hopkins K, Gallager S, York A, Taylor R, Sullivan PJ (2018) Invasive tunicate restructures invertebrate community on fishing grounds and a large protected area on Georges Bank. Biological Invasions 20: 87–103. https://doi.org/10.1007/s10530-017-1517-y
  • Kott P (1985) The Australian Ascidiacea. Part 1., Phlebobranchia and Stolidobranchia. Memoirs of the Queensland Museum 23: 1–440.
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 35: 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Lambert G (2001) A global overview of ascidian introductions and their possible impact on the endemic fauna. In: Sawada H, Yoksawa H, Lambert CC (Eds) The Biology of Ascidians. Springer, Tokyo, 249–257. https://doi.org/10.1007/978-4-431-66982-1_40
  • Lenzner B, Latombe G, Capinha C, Bellard C, Courchamp FF, DIagne C, Dullinger S, Golivets M, Irl SDH, Kuhn I, Leung B, Liu C, Moser D, Roura-Pascual N, Seebens H, Turbelin A, Weigelt P, Essl F (2020) What will the future bring for biological invasions on islands? An expert-based assessment. Frontiers in Ecology and Evolution 8: 280. https://doi.org/10.3389/fevo.2020.00280
  • Lehtiniemi M, Ojaveer H, David M, Galil B, Gollasch S, McKenzie C, Minchin D, Occhipinti-Ambrogi A, Olenin S, Pederson J (2015) Dose of truth—monitoring marine non-indigenous species to serve legislative requirements. Marine Policy 54: 26–35. https://doi.org/10.1016/j.marpol.2014.12.015
  • López-Legentil S, Turon X, Schupp P (2006) Chemical and physical defenses against predators in Cystodytes (Ascidiacea). Journal of Experimental Marine Biology and Ecology 332: 27–36. https://doi.org/10.1016/j.jembe.2005.11.002
  • McGeoch MA, Butchart SHM, Spear D, Marais E, Kleunhans EJ, Symes A, Chanson J, Hoffmann M (2010) Global indicators of biological invasion: Species numbers, biodiversity impact and policy responses. Diversity and Distributions 16: 95–108. https://doi.org/10.1111/j.1472-4642.2009.00633.x
  • Martín-Solà M (2022) Caracterización de las comunidades de invertebrados marinos asociados a entornos portuarios de las islas Canarias. MSc Thesis. Universidad de La Laguna, La Laguna, Spain, 88 pp.
  • Monniot C (1983) Ascidies littorales de Guadeloupe. IV. Styelidae. Bulletin du Museum national d’Histoire naturelle, Paris, 4e sér 5(2): 423–456. https://doi.org/10.5962/p.285972
  • Monniot C, Monniot F (1984) Ascidies littorales de Guadeloupe. VII. Espèces Nouvelles et complémentaires a l’inventaire. Bulletin du Museum national d’Histoire naturelle, Paris, 4e sér 6(3): 567–582. https://doi.org/10.5962/p.285903
  • Monniot C, Monniot F (1994) Additions to the inventory of eastern tropical Atlantic ascidians; arrival of cosmopolitan species. Bulletin of Marine Science 54: 71–93.
  • Monniot C, Monniot F, Griffiths CL, Schleyer M (2001) South African ascidians. Annals of the South African Museum 108: 1–141.
  • Monniot F, Monniot C (2003) Ascidies de la pente externe et bathyales de l’ouest Pacifique. Zoosystema 25: 681–749.
  • Moreno-Dávila B, Huato-Soberanis L, Gómez-Gutiérrez J, Galván-Tirado C, Alcoverro T, Balart EF, Turon X (2023) Taxonomic identity of Distaplia stylifera (Tunicata, Ascidiacea), a new arrival to the eastern Pacific displaying invasive behavior in the Gulf of California, Mexico. ZooKeys 1157: 109–125. https://doi.org/10.3897/zookeys.1157.95986
  • Nishikawa T (1991) The ascidians of the Japan Sea II. Publications of the Seto Marine Biological Laboratory 35: 25–170. https://doi.org/10.5134/176172
  • Pajuelo JG, González JA, Triay-Portella R, Martín JA, Ruiz-Díaz R, Lorenzo JM, Luque A (2016) Introduction of non-native marine fish species to the Canary Islands waters through oil platforms as vectors. Journal of Marine Systems 163: 23–30. https://doi.org/10.1016/j.jmarsys.2016.06.008
  • Paulay G, Kirkendale L, Lambert G, Meyer C (2002) Anthropogenic biotic interchange in a coral reef ecosystem: A case study from Guam. Pacific Science 56: 403–422. https://doi.org/10.1353/psc.2002.0036
  • Pineda MC, Lopez-Legentil S, Turon X (2013) Year-round reproduction in a seasonal sea: biological cycle of the introduced ascidian Styela plicata in the Western Mediterranean. Marine Biology 160: 221–230. https://doi.org/10.1007/s00227-012-2082-7
  • Rho BJ, Park KS (1998) Taxonomy of ascidians from Geojedo Island in Korea. The Korean Journal of Systematic Zoology 14: 173–192.
  • Rius M, Pineda MC, Turon X (2009) Population dynamics and life cycle of the introduced ascidian Microcosmus squamiger in the Mediterranean Sea. Biological Invasions 11: 2181–2194. https://doi.org/10.1007/s10530-008-9375-2
  • Rius M, Turon X, Morán P, Pérez J, Almón B, Pahad G, Teske PR, Vázquez E (2024) A morphogenetic characterisation of a potentially dominant African marine species in Europe. Biological Invasions 26: 2811–2818. https://doi.org/10.1007/s10530-024-03354-x
  • Rocha RM, Bonnet NYK, Baptista MS, Beltramin FS (2012) Introduced and native Phlebobranch and Stolidobranch solitary ascidians (Tunicata: Ascidiacea) around Salvador, Bahia, Brazil. Zoologia 29: 39–53. https://doi.org/10.1590/S1984-46702012000100005
  • Romeo T, D’Alessandro M, Esposito V, Scotti G, Berto D, Formalewicz M, Noventa S, Giuliani S, Macchia S, Sartori D, Mazzola A, Andaloro F, Giacobbe S, Deidun A, Renzi M (2015) Environmental quality assessment of Grand Harbour (Valletta, Maltese Islands): a case study of a busy harbour in the Central Mediterranean Sea. Environmental Monitoring and Assessment 187: 1–21. https://doi.org/10.1007/s10661-015-4950-3
  • Ruiz MB, Taverna A, Servetto N, Sahade R, Held C (2020) Hidden diversity in Antarctica: Molecular and morphological evidence of two different species within one of the most conspicuous ascidian species. Ecology and Evolution 10: 8127–8143. https://doi.org/10.1002/ece3.6504
  • Sax DF, Gaines D (2008) Species invasions and extinction: The future of native biodiversity on islands. Proceedings of the National Academy of Sciences of the United States of America 105: 11490–11497. https://doi.org/10.1073/pnas.0802290105
  • Simberloff D (1995) Why do introduced species appear to devastate islands more than mainland areas? Pacific Science 49: 87–97.
  • Stefaniak L, Lambert G, Gittenberger A, Zhang H, Lin S (2009) Genetic conspecificity of the worldwide populations of Didemnum vexillum Kott, 2002. Aquatic Invasions 4: 29–44. https://doi.org/10.3391/ai.2009.4.1.3
  • Stoecker D (1980) Relationships between chemical defense and ecology in benthic ascidians. Marine Ecology Progress Series 3: 257–265. https://doi.org/10.3354/meps003257
  • Svane I, Young CM (1989) The ecology and behaviour of ascidian larvae. Oceanography and Marine Biology: an Annual Review 27: 45–90.
  • Tempesti J, Langeneck J, Maltagliati F, Castelli A (2020) Macrobenthic fouling assemblages and NIS success in a Mediterranean port: The role of use destination. Marine Pollution Bulletin 150: 110768. https://doi.org/10.1016/j.marpolbul.2019.110768
  • Tyrrell MC, Byers JE (2007) Do artificial substrates favor nonindigenous fouling species over native species? Journal of Experimental Marine Biology and Ecology 342: 54–60. https://doi.org/10.1016/j.jembe.2006.10.014

Supplementary material

Supplementary material 1 

Alignment of the sequences used in the phylogeny reconstruction

Xavier Turon, Marc Martín-Solà, Leopoldo Moro-Abad, José Carlos Hernández

Data type: fas

Explanation note: GenBank accession numbers are indicated.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (30.26 kb)
login to comment